Sequence  [Back]

>HPRM43640 NM_001361;name=DHODH;Entrez_ID=1723;Genome=hg38;chr16+:72007326-72008748;TSS=72008744;Upstream=1418,Downstream=4;Length=1423;
TGGCGGGAACACTGCAACTGGACAAAAATGACACGGATGGGTGTAGAGCCTCCAAACAAT
AAGTATCTGATTAATGCTGTTGACACCTAAGTCTACAGAGGCTATTCTCCAACGGCCAGG
ACATCATTAGGTAAGACATTTCAAAATTCTTCGTGAGGGCACGATTGCTTCAGAGGACTA
CAAAGTGACACATTAGGTCGTCATAAATCACCGCAGTACCATCCTGGCTAACACGGTGAA
ACCCCGTCTCTAAAATACAAAACAATGAGCCGGGCATGGTTGCGGGCGCCTGTAGTCCCA
GCTACTCGGGAGGCTGACGCAGGAGAATGGCGTGAACCCGGGAGGCGGAGCTTGTAGTGA
GCCGAGATCGCGCCACTGCACTGCAGCCTGGGCAACAGAGCAAGACTCTGTCAAAAAAAA
AAAAAAAAAAAAAAAAAAATCACCGCAGTAAACCACACTCCAACGGGCCTGCACACTCAG
GGTCTTGATTAGAAACAGTATTTAAAAAAATACCTCCACATCTGTTGCACCACAATGCCA
AGGTATAACCAGGGCCACTTTCTCCAGGAGGCACAACAGGCGCAGGGCCAGGGAAGGGCC
TCTGACACTTTTAGGATCTCAAGAAATTTTTTTTTTTTGGTTATTTTTCTTTGTTTGTTT
TTGAGACAGAGTCTTGCTTTGTCGCCCAGGCTGGAGTGCAGTGGTGCTATCTCGGCTCAC
TGCAACCTCCACCTTCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTACCTGGG
ATTACAGGCGCCTGCCACTACGCCCGGCTAATTTTTGTATTTTATTTTATTTTTTAGTAG
ACACGGGGTTTTGGGTGTTGACCAGGTCTCGAACTCCTGACCTCAAGTGATCTGCCTGCC
TCAGCCTCCCAAAGTGCTGGGACTACAGGCGTGAGCCACCATGCCCGGCCTCAAGAAAAT
GTTTTAATTTCCTTAAAAAACCTTAAGAAAAATCAACTTTTAAGTTGAAAAAGTTTATAT
ATTAACATATTCATCTTTATATCAACACAGCAGTAAAATTTATTTTTTAAAGTGATAAAA
ACTGTACAAATATTTCTGGTGTGAAACACAGTGTTTTGATGCTCGCGGACTCTTGGATTC
GAGGCTGCGGTAGTACGGACAAACACCGTGCAGCGGCATCTCATCTCCGCCAACAGCCGG
CGATCAAGCGGGCAGGCTGGGAGAGGGCGGGCGGAAGAGGCGTGGCCGCCGCTACTGCGC
ACGTGCACCCAACCAGAACCTGGGGGTGGTGCCGGGCCTTCCCCGCTGCGCGGAGGCGTC
CTCTCAACCCTTCTGCCCGGCGACTGGTGGGTTGGCGGCTAAGGGGCGGAGACAAGAGGG
GCCGCCACCATCTCCTCCAATGGAAGGGAGACAGGGGCGGGCT

Note: The base labeled in red is the transcription starting site (TSS). The sequence presented here is used as a reference from NCBI for the customer. The sequence of the actual clone product may differ due to genetic variation and alternative splicing.