Sequence  [Back]

>HPRM38915 NM_001207030;name=LOC643802;Entrez_ID=643802;Genome=hg38;chr16-:53372470-53371024;TSS=53371129;Upstream=1341,Downstream=105;Length=1447;
CCCTTGAGTTCCTGGCTCACAGCGACTACAGACTGAGCTTAGTTGGAATTCAGTAGCACA
CAACTGGGATATCCGCACTGTACGGCTTTTAACAATTTTTAAAATTTTGGTACTCTCAGC
ATCGCAAATTCACTGTGTCCAAAATAGAGTAGAATGTTGTTCTACCCACCTATACTCTGC
CATCCGCTGAAGTCCTTTCCCCATGCTCCAGCACTCAAGCCTTGCCTGTCACAGTAAATG
GCAGTTCTGTCTTTCCTGTTGCTCACACATAAAACTAGGCTGCTATTTTGATGTCTTCAT
TTTTCTCTATTCTGTATCTAATTCCTTAGCAATCCTGTCAGTTCTACCTCCAGACTGTAC
TCAGCATATTCACTGCTCTAACTCCAGCTTAAATCACCATCATCCTTTGCCTGGAATGCT
GCATCAACCTTCTAATCACTCTACTTTCCTCCTCCTCCTTCCTCCCTTTCTTCTTCCTTC
TTGTAAATCATCATTTCATCCTTCTGCTTAAAATCTTCTCATGTTTTCTTATTACACTTA
AAATGGCAAACTCTTACCCTTGAGCCCTGTAGAATTTGGCTCCCATCAGTTTCTCCAATT
TCACCTTCTGCCTCCTTCACACTCTAGCTGTGCTCACTTTTTTATTCCTCAGGCCTACCA
AGCTCAATTGCATCTTAGAGAATTTGTTCTTGCTGTTTCTTCTGCCTGGAATACATGTTT
CCCAATCTTTATAAGACTATCCTTATCTGTAGGTTTCATCTGAGATGTCACATCCAAAAG
AGGTTTTCCTTGACCACTGTAGCCAAAGCAAATGTTGATCACTGAAGGAATAAGGGAATG
AATGAATGGAGTGGTGTATAATATAGCAGAGTTGATAATTTAAGGCTAATTCACTATGTA
TCTCCAAGCAAACAGATTTGTAATGCTTTTCCTGCCTAAAATCTATACAGCTGATTCACA
AATACTTGATTGACAGGTTTTATATATCACTGTGGCTCATCAGCTTGTATGTTGTTGGGG
CCAGAATCTATACTTACACTTCATTCAAATTTGATTTTACAGAAGAGTTGGGGTTTTTAT
TTTTCTTTTAATTAAGAGAGCTGTGAAATTATTACCTATAATTCTAAATCTCATTTAATT
CCTCCCAATAGGATTCAAGATGGATTGTCATCAAAGTTCACTTCTTTAACAAAAGTGGTT
TATGACTTTAATAAAATATTAGAGAATGGAAGGATCTGTGGAAGCCCTTTACAAAAACTT
GTGATAGAAAGTTTTGATGATGAGCAGACTTTGCAACAACTGGAATTGCAAAATGAACCA
ATTTTACAATGCTTCCAAAATGCAGTTAGTGAAACAAAGATGAAGACATCAGTCTTCTCC
CAGAGAGTGAAGAACAGGAGTGTGAAGAGGATGGTTCAGAGACAGAGACTGGTGGCCAGG
AGGACCT

Note: The base labeled in red is the transcription starting site (TSS). The sequence presented here is used as a reference from NCBI for the customer. The sequence of the actual clone product may differ due to genetic variation and alternative splicing.