Sequence  [Back]

>HPRM25756 NM_003998;name=NFKB1;Entrez_ID=4790;Genome=hg19;chr4+:103421137-103422709;TSS=103422486;Upstream=1349,Downstream=223;Length=1573;
AGCCACCGCACCCGGCTCACAGAATTTCTTAAAAAGTCATTGTGTTCAGTCTTTATGGAT
CCTCTAAATTCCAGCTGCTCAGCCTCCCGGAGCTAAATGAGATCACTTAAAGGTCGACTG
TTGGGGCCTCCAAGGTCGCCTCGGAGACTCACCTCATAGGCAATCAAATGGATCGCTGGG
TTTTTGTGTGTGTGGGTTTTTTTTGTTTATTTTTTTTTTCCAGAAAAACACTCCACCAAG
AAGGTTTTTATAACCTACTGGAGGAGGAGGATGGAGAGTGGGCACGAAAGGACTAGGATG
AACATGCCATAAGCAATCTAAATGCCACTGCAATATTGCCTGGTGAGGACCTGATTACTG
ATGTTTTAAAGCTAAGCTTTCAGTTGTCACTCCACCCAGTAGTGAAACAATGAGCTCTAA
AATATATATTTCGGCTCAAGCTTTCTTATGTGGGGAGGTAATCCACCCGAAGGTATCCCC
AGCCTGTACCTAATACAGTGCCCAGCACTAAAGCAGCTCAGATGCCAGTGAATGGTGGCC
ACTGGGAGGCCTGTCAGTGGGTGCCAGTAGCGGTCTCTTCAGAGAAAAAGAAAACTCCCC
TCTGCCAGATCAGTATTTTATGAGCTGTGAACCAAAACCATTGCTACCACCATCACTATA
ATTCTATCCACAGTAATTATCATAAAGGCCTAACAATGCCTTGTAGATGAACATTCTGAG
TAACTGCTCTATAACCAGGAGATTTAAGACCGCACCAAAAACCAGTAGAGGGTTATACTT
TACTGGGCACAAGTCGTTTATGATAACGAAATTGTAGTTTAATCTGTGAAGAGATGTGAA
TGTAACTGAGACACGCTTAAATGGAATATACAGATGAGCTTTATTTTTATATCTGGCATG
CTTGGATCCATGCCGACCCTCCAGCTGCTCGGGCCTGCCCTTAGGGGCTATGGACCGCAT
GACTCTATCAGCGGCACTGCCACCGCCGCCGCCTCCGTGCTGCCTGCGTTCCCCGACCAT
TGATTGGGCCCGGCAGGCGCTTCCTGGGGGCTTCCCTACCGGCTCCAGCCCTTGGGATTC
GGGAGCGCCCTGCTAGGAAGCCAGAGCCCCGCAGGGGCCGCGGCGTCCAGGCCGCCTAAC
GCGCGCCCCTCGCCCGGCGCCCCGAAGCGGCCCCGAGGGGCGGGAGCCGAGGCGAGCGGC
AAGGCCGGGCCGGGGGCGCACAGCGCCCCTAGAAGTGCGGGCTTCCCCCACCCCCGGCAG
CGACCCTACCTCCCGCCCCCGCTGCGTGCGCGCGTGTGTCCGTCTGTCTGTATGCTCTCT
CGACGTCAGTGGGAATTTCCAGCCAGGAAGTGAGAGAGTGAGCGAGACAGAAAGAGAGAG
AAGTGCACCAGCGAGCCGGGGCAGGAAGAGGAGGTTTCGCCACCGGAGCGGCCCGGCGAC
GCGCTGACAGCTTCCCCTGCCCTTCCCGTCGGTCGGGCCGCCAGCCGCCGCAGCCCTCGG
CCTGCACGCAGCCACCGGCCCCGCTCCCGGAGCCCAGCGCCGCCGAGGCCGCAGCCGCCC
GGCCAGTAAGGCG

Note: The base labeled in red is the transcription starting site (TSS). The sequence presented here is used as a reference from NCBI for the customer. The sequence of the actual clone product may differ due to genetic variation and alternative splicing.