Sequence  [Back]

>HmiT066376 3'UTR
attgcctctgcttacgttcaggccctgtcctaaacccagccgtctagcacccagtgatcc
catgcctttgggaatcccaggatgctgcccaacgggaaatttgtacattgggtgctatca
atgccacatcacagggaccagccatcacagagcaaagtgacctccacgtctgatgctggg
gtcatcaggacggacccatcatggctgtctttttgccccaccccctgccgtcagttcttc
ctttctccgtggctggcttcccgcactagggaacgggttgtaaatggggaacatgacttc
cttccggagtccttgagcacctcagctaaggaccgcagtgccctgtagagttcctagatt
acctcactgggaatagcattgtgcgtgtccggaaaagggctccatttggttccagcccac
tcccctctgcaagtgccgcagcttccctcagagcatactctccagtggatccaagtactc
tctctcctaaagacaccaccttcctgccagctgtttgcccttaggccagtacacagaatt
aaagtgggggagatggcagacgctttctgggacctgcccaagatatgtattctctgacac
tcttatttggtcataaaacaataaatggtgtcaatttcaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaa

Note: The sequence presented here is used as a reference from NCBI for the customer. The sequence of the actual clone product may differ due to genetic variation and alternative splicing.