Select miRNA precursors, inhibitors and qPCR primers

Precursor miRNA Name: rno-let-7d   Precursor miRNA Accession: MI0000601
Description: Rattus norvegicus let-7d stem-loop
Precursor Sequence:
Read Warranty Statement

MicroRNA Lentivirus NEW! Order your microRNA as lentivirus
Search now

Mature miRNA family member(s):
Mature miRNA name Mature miRNA accession Mature sequence Predicted targets (related miRNA target clones)
rno-let-7d-5p MIMAT0000562 agagguaguagguugcauaguu    TargetScan(247)
rno-let-7d-3p MIMAT0000563 cuauacgaccugcugccuuucu   

Add products to shopping cart to view prices

  • miRNA clones
  • miRNA inhibitors
  • miRNA qPCR primers & kits
  • Packaging kits & competent cells

Product ID: RmiR6006
Delivery format:  purified plasmid
Estimated Delivery: Varies. Please email for ETA

Precursor miRNA clones in lentiviral and non-viral vectors
Buy Catalog# Promoter Selecting Marker Reporter Gene Vector Viral type
RmiR6006-MR03 CMV Puromycin eGFP pEZX-MR03 HIV
RmiR6006-MR04 CMV Puromycin eGFP pEZX-MR04 n/a

Synthetic miRNA mimics
Buy Catalog# Description Size Price (US$)
RmiR-SN0007-SN-2.5 synthetic oligonucleotide for rno-let-7d-5p 2.5 nmol inquire
RmiR-SN0007-SN-5 synthetic oligonucleotide for rno-let-7d-5p 5 nmol inquire
RmiR-SN0007-SN-10 synthetic oligonucleotide for rno-let-7d-5p 10 nmol inquire
RmiR-SN0008-SN-2.5 synthetic oligonucleotide for rno-let-7d-3p 2.5 nmol inquire
RmiR-SN0008-SN-5 synthetic oligonucleotide for rno-let-7d-3p 5 nmol inquire
RmiR-SN0008-SN-10 synthetic oligonucleotide for rno-let-7d-3p 10 nmol inquire

Synthetic miRNA controls
Buy Catalog# Description Size Price (US$)
CmiR-SN0001-SN Synthetic scrambled control oligonucleotide for miRNA 1.25 nmol inquire

Product ID:  RmiR-AN0007 RmiR-AN0008 
Delivery format:  purified plasmid
Estimated Delivery: Varies. Please email for ETA
miRNA inhibitors in lentiviral and non-viral vectors
Buy Catalog# Against miRNA Promoter Selection marker Reporter gene Vector Viral type
RmiR-AN0007-AM01 rno-let-7d-5p H1 Puromycin mCherry pEZX-AM01 NA
RmiR-AN0007-AM02 rno-let-7d-5p U6 Puromycin mCherry pEZX-AM02 NA
RmiR-AN0007-AM03 rno-let-7d-5p H1 Hygromycin mCherry pEZX-AM03 HIV
RmiR-AN0007-AM04 rno-let-7d-5p U6 Hygromycin mCherry pEZX-AM04 HIV
RmiR-AN0008-AM01 rno-let-7d-3p H1 Puromycin mCherry pEZX-AM01 NA
RmiR-AN0008-AM02 rno-let-7d-3p U6 Puromycin mCherry pEZX-AM02 NA
RmiR-AN0008-AM03 rno-let-7d-3p H1 Hygromycin mCherry pEZX-AM03 HIV
RmiR-AN0008-AM04 rno-let-7d-3p U6 Hygromycin mCherry pEZX-AM04 HIV

Synthetic miRNA inhibitors
Buy Catalog# Description Size Price (US$)
RmiR-AN0007-SN-5 synthetic oligonucleotide against rno-let-7d-5p 5 nmol inquire
RmiR-AN0007-SN-10 synthetic oligonucleotide against rno-let-7d-5p 10 nmol inquire
RmiR-AN0007-SN-20 synthetic oligonucleotide against rno-let-7d-5p 20 nmol inquire
RmiR-AN0008-SN-5 synthetic oligonucleotide against rno-let-7d-3p 5 nmol inquire
RmiR-AN0008-SN-10 synthetic oligonucleotide against rno-let-7d-3p 10 nmol inquire
RmiR-AN0008-SN-20 synthetic oligonucleotide against rno-let-7d-3p 20 nmol inquire

Synthetic miRNA inhibitor controls
Buy Catalog# Description Size Price (US$)
CmiR-AN0001-SN Synthetic scrambled control oligonucleotide for miRNA inhibition 2.5 nmol inquire

Product ID: RmiRQP0007 RmiRQP0008 
Estimated Delivery: Typically ships in 2 weeks

Validated miRNA qPCR primers and qRT-PCR detection kit — Click on Catalog# for validation results
Buy Catalog# Description Note
RmiRQP0007 qPCR primer against mature miRNA rno-let-7d-5p(200 reactions) All-in-One™ miRNA qPCR Primer
RmiRQP0008 qPCR primer against mature miRNA rno-let-7d-3p(200 reactions) All-in-One™ miRNA qPCR Primer
RmiRQP9003 Rattus snRNA U6 Qpcr Primer(200 reactions) All-in-One™ miRNA Reference Primer
QP115 20µLx20 RT reactions and 20µLx200 PCR reactions All-in-One™ miRNA qRT-PCR Detection Kit 2.0
QP116 20µLx60 RT reactions and 20µLx600 PCR reactions All-in-One™ miRNA qRT-PCR Detection Kit 2.0

Estimated Delivery: Ships immediately

Buy Catalog# Description
LT001 Lenti-Pac™ HIV Expression Packaging Kit
LT002 Lenti-Pac™ HIV Expression Packaging Kit
LT008 Lenti-Pac™ 293Ta Cell Line
CC001 GCI-5α Chemically Competent E.coli Cells, (10 tubes)
CC002 GCI-5α Chemically Competent E.coli Cells, (20 tubes)
CC003 GCI-L3 Chemically Competent E.coli Cells (10 tubes)
CC004 GCI-L3 Chemically Competent E.coli Cells (20 tubes)

